How to Explain DNA to Kids

DNA made Simple

DNA stands for deoxyribonucleic acid and is one of the two types of nucleic acid found in our cells. The name describes what the molecule is. DNA is:

A Nucleic Acid (i.e. it is made up of strings of nucleotides bonded together) Has a backbone made of phosphate and deoxyribose

As my hub series What is DNA? shows, DNA is beautifully intricate and works in complicated mechanisms to control the cell.

But

As a teacher, I am a strong believer that you can teach anyone, anything. The younger the student, the more likely they are to retain it. So – let us take a look at how you would explain DNA to a six-year-old

Cells – the Building Blocks of Life

We are all made of trillions of cells. There are around 2.5 billion cells in one of your hands, but they are tiny. So tiny that we cannot see them. If every cell in your hand was the size of a grain of sand, your hand would be the size of a school bus!

Each cell has its own job, just like humans do. Some cells help us detect light and see, other cells help us touch, some cells help us hear, other cells carry oxygen around, other cells help us digest food by secreting enzymes. There are over 200 cell types in the body – that is 200 different jobs!

But how does each cell know what job to do ? Well how does human know what job it has to do? – someone tells us. Our cells are also told what to do, but not by a person or a computer! Our cells are told what to do by a very special molecule called DNA

DNA is the Instructions for Life

DNA is a record of instructions telling the cell what it’s job is going to be. A good analogy for DNA as a whole is a set of blueprints for the cell, or computer code telling a PC what to do. It is written in a special alphabet that is only four letters long! Unlike a book or computer screen, DNA isn’t flat and boring – it is a beautiful curved ladder. We call this shape a double helix. The letters of the DNA alphabet (called bases) make up the rungs, special sugars and other atoms make up the handrail.

The rungs are very special. Each one has a name, but they prefer to be called by their initials: A, T, C and G They don’t like to be by themselves so always pair up with a friend. But they are very choosy about their friends:

A and T are best friends and always hang out together
G and C are best friends and always hang out together

Another way of looking at it is that A, T, G and C are like jigsaw pieces. A and T fit together, C and G fit together – you cannot force a jigsaw piece to fit in the wrong place – just like in the picture!

Four letter alphabet

Think of all the words you can spell. I bet there are loads. But each word is made using the same selection of letters. Yes, sometimes we leave letters out, sometimes we repeat letters, but we always have the same selection of letters. Depending on how we arrange the letters of the alphabet we can make new words. The same is true in the four letter alphabet of DNA

If you look at a length of DNA, you can read out the letters all in a row:

ATGCGTGGTCAGTCGATATATGGCCCC

These letters make up words that are always three letters long . These are called codons

ATG CGT GGT CAG TCG ATA TAT GGC CCC

These words make up sentences that the cell understands. These sentences are called genes.

[ATG CGT GGT CAG] [TCG ATA TAT GGC CCC]

Each sentence tells a cell to make a special molecule called a protein. These proteins control everything in a cell. In this way, DNA is like the boss of a company, and not the brain of the cell. It issues instructions, but doesn’t do very much of the actual work 🙂 These proteins help each cell do its job. Each gene makes one protein, and only one protein.

Just 4 letters?

How can four letters make something as complicated as a human body? Let us take a trip back to my favourite childhood toy – Lego.

Give a child 80 lego pieces of one colour and ask them to build a tower. No matter how they try, they can only make one possible combination of colours.

Now give a child a box of lego with 20 lots of 4 different colours and ask them to make a tower. The size is still the same, but the combination and order of colours is different each time they build. The possibilities are endless…well not quite, but still quite large.

Remember it is the sequence of letters (order of the colours in this analogy) that stores the information. Each set of 3 letters is a word. With four different letters, there are 64 possible three-letter-words. Imagine how many combinations of these words there are in a sentence just 100 letters long!

DNA Elegantly Simple, Wickedly Complicated

I hope this has shown you that the basics of DNA are simple and straightforward. Whenever you are trying to convey complex ideas to young children, analogies are your friend. Just make sure they know what the analogy means, and they are not just saying “DNA is like lego” or “cells are like buses”

Let me know if this was useful, and please comment and give feedback. Before you go -check out the links. There is a wonderful flash animation that takes you through the Basics of DNA. Well worth a look.

, How to Explain DNA to Kids www.ozeldersin.com bitirme tezi,ödev,proje dönem ödevi

Categories:

Tez Ödev Talep Formu

Son Faaliyetler
Ağustos 2026
P S Ç P C C P
 12
3456789
10111213141516
17181920212223
24252627282930
31